|
TaKaRa
human thymus marathon ready cdna library ![]() Human Thymus Marathon Ready Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human thymus marathon ready cdna library/product/TaKaRa Average 94 stars, based on 1 article reviews
human thymus marathon ready cdna library - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Clinical Cancer Research
Article Title: High Expression of a New Marker PCA-1 in Human Prostate Carcinoma
doi: 10.1158/1078-0432.ccr-05-0195
Figure Lengend Snippet: Fig. 6. Real-time PCR analysis of pca-1mRNA expression in normal human tissues. The tissue-specific expression of pca-1mRNA was determined by an SYBR Green I ^ based quantitative PCR assay in normalized cDNA samples derived from15 different human tissues.The expression levels of PCA-1transcript in the human tissues were normalized for the expression levels of the b-actin transcripts in the same cDNAs.1, brain; 2, thymus; 3, heart; 4, lung; 5, liver; 6, spleen; 7, pancreas; 8, smallintestine; 9, colon;10, kidney;11, prostate;12, testis;13, ovary;14, peripheral blood leukocyte;15, placenta. Columns, averages of three independent measurements per tissue.
Article Snippet: The 5V-RACE (rapid amplification of cDNA ends) method was done to isolate the 5V-end portion of the newly identified cDNAs (activator protein, CCATCCTAATACGACTCACTATAGGGC; PCA-1-RACE, CTGTTCCCACAGTAGACC) using the
Techniques: Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay, Derivative Assay